G-P303*, also known as G2a2b2a* (previously G2a3b1*), and its subclades are now concentrated in southern Russia and the Caucasus, as well as, at lower levels, other parts of Europe and South West Asia, especially an area including Turkey, Iran and the Middle East where G2a2b2a may have originated. Lacan M, Keyser C, Ricaut FX et al. It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. These latter labs also made use of raw data results reported by individuals tested for about 2,000 SNPs at 23andMe to provide new L or S-designated SNP tests. Men who belong to this group but are negative for all G2 subclades represent a small number of haplogroup G men. Then we applied a 10% overall hg G frequency threshold and the additional specification that both haplogroup G1 and G2 lineages also be present. Y-chromosomal evidence of the cultural diffusion of agriculture in Southeast Europe. In north-eastern Croatia, in the town of Osijek, G was found in 14% of the males. You belong to a subgroup of haplogroup G (G-M201), The Caucasus Mountaineers, and your oldest. The L141 mutation involves an insertion.[35]. The G2 clade consists of one widespread but relatively infrequent collection of P287*, M377, M286 and M287 chromosomes versus a more abundant assemblage consisting of G2a-related P15*, P16 and M485-related lineages. The L91 mutation is found at 21327383 and rs35474563 on the Y-chromosome. [citation needed] OS thanks the Italian Ministry of the University: Progetti Ricerca Interesse Nazionale 2009 and FIRB-Futuro in Ricerca 2008 and Fondazione Alma Mater Ticinensins. The hg G individuals in Supplementary Table S1 were either first genotyped for this study or updated to present phylogenetic resolution from earlier studies.2, 4, 10, 11, 13, 16, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 All hg G (M201-derived) samples were genotyped in a hierarchical manner for the following binary markers: M285, P20, P287, P15, L91 P16, M286, P303, U1, L497, M406, Page19, M287 and M377. The Morans I coefficient was calculated using the PASSAGE software v.1.1 (Phoenix, AZ, USA) with binary weight matrix, nine distance classes and random distribution assumption. Drawing the history of the Hutterite population on a genetic landscape: inference from Y-chromosome and mtDNA genotypes. G2a2b2a is also found in India. Science 2000; 290: 11551159. Y-chromosomal diversity in Europe is clinal and influenced primarily by geography, rather than by language. The 96 populations were collapsed into 50 regionally defined populations by excluding populations where the total G count was less than n=5. Y chromosome sequence variation and the history of human populations. Although progress has been recently made in resolving the haplogroup G phylogeny, a comprehensive survey of the geographic distribution patterns of the significant sub-clades of this haplogroup has not been conducted yet. Excavating Y-chromosome haplotype strata in Anatolia. Haplogroup G ( M201) is a human Y-chromosome haplogroup. It is a child of haplogroup M12'G. It was likely born in the East Asia around 32,000 years ago. (2000) suggested 17,000 years ago. Internet Explorer). In descending order, G-P303 is additionally a branch of G2 (P287), G2a (P15), G2a2, G2a2b, G2a2b2, and finally G2a2b2a. Conversely, hg G is present in Northeast Caucasus only at an average frequency of 5% (range 019%). Origins and history of European Y-DNA and mtDNA haplogroups The hg G2a3b1c-L497 sub-cluster, on the other hand, has so far been found essentially in European populations and therefore is probably autochthonous to Europe. Until 2008, new G SNPs were reported from labs at the University of Arizona (P designations), Stanford University (M designations) or the University of Central Florida (U designations). The geographic origins of a Y chromosome haplogroup for males can be deciphered from the phylogenetic tree of mankind, or the Y-DNA Haplogroup Tree, maintained by the International Society of Genetic Genealogy ( ISOGG, 2016 ). The reliability of both P16 and P18 in identifying everyone in each of these categories has been questioned and individual components of the SNP have to be examined. The following SNPs are so far identified as M201 equivalents: L116, L154, L269, L294, L240, P257, L402, L520, L521, L522, L523, L605, Page 94, U2, U3, U6, U7, U12, U17, U20, U21, U23 and U33. Marie Lacan, Christine Keyser, Franois-Xavier Ricaut, Nicolas Brucato, Francis Duranthon, Jean Guilaine, Eric Crubzy, and Bertrand Ludes, Ancient DNA reveals male diffusion through the Neolithic Mediterranean route. The origin of haplogroup G is controversial. Mol Biol Evol 2011; 28: 29052920. Also for P15* and L91 lineages Td estimates, DYS19 was excluded owing to duplications in these lineages.36. Haplogroup Definition & Meaning | Dictionary.com The 12f2a mutation, which characterizes haplogroup J, was observed in 445 subjects. See: Poznik. Rosser ZH, Zerjal T, Hurles ME et al. The Network 4.6.0.0 (Fluxus-Engineering) program was used (median-joining algorithm and the post-processing option). (Previously the name Haplogroup S was assigned to K2b1a4. BMC Evol Biol 2011; 11: 69. The extreme rarity of G-M377 in northern Pakistan could indicate that G2b in this area originates outside the region and was brought there in the historic period, perhaps from further west (Pakistan was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). It is one of two branches of the parent haplogroup GHIJK, the other being HIJK . Haplogroup G-M285 - Wikipedia In the G2a3b-P303 network (Figure 4), there are several region-specific clusters, indicating a considerable history for this SNP. [12] The fourth site also from the same period is the tztal of the Italian Alps where the mummified remains of tzi the Iceman were discovered. It is provided at the request of readers. Haplogroup G2a1 (also known as G-FGC753 and previously as G-L293) and its subclades represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. Y chromosome genetic variation in the Italian peninsula is clinal and supports an admixture model for the Mesolithic-Neolithic encounter. The overall coalescent age estimate (Supplementary Table S4) for P303 is 12600 years ago. Evaluation of Y-chromosomal STRs: a multicenter study. Hg G also occurs at frequencies ranging from 5 to 15% in both the rest of Near/Middle East and southern European countries (especially Italy and Greece), with a decreasing frequency gradient towards the Balkans and northern Europe. G-PF3147 (previously G-L223 and G-PF3146) is characterized by having the L223 mutation. Eur J Hum Genet 2010; 18: 348353. Haak W, Balanovsky O, Sanchez JJ et al. It is not found among Native Americans except where intermarriage with non-native persons has occurred. The genetic variation in the R1a clade among the Ashkenazi - Nature But unusual values or unusual value combinations found at short tandem repeat markers (STRs) can also provide the basis of additional taxonomisation. The suggested relevant pre-historical climatic and archeological periods specified in conjunction with lineage-specific estimated expansion times are specified in the summary portion of Supplementary Table S4. Zhivotovsky LA, Underhill PA, Feldman MW : Difference between evolutionarily effective and germ line mutation rate due to stochastically varying haplogroup size. These Neolithic European were descendants of Neolithic farmers from Anatolia, among some of the earliest peoples in the world to practice agriculture. The most detailed SNP mutation identified was S126 (L30), which defines G2a3.[11]. Luis JR, Rowold DJ, Regueiro M et al. Am J Hum Genet 2007; 80: 759768. Haplogroup G (Y-DNA) - Origins - LiquiSearch This group was created for the folks who's paternal Y-DNA reflects they belong to haplogroup G2a (G-P15). This value of 12 is uncommon in other G categories other than G1. Nasidze I, Quinque D, Dupanloup I et al. Kaniewski D, Van Campo E, Van Lerberghe K et al. Notably no basal G-M201*, Page94*(xM285, P287) chromosomes were detected in our data set. P15 was identified at the University of Arizona and became widely known by 2002. K-M2313*, which as yet has no phylogenetic name, has been documented in two living individuals, who have ethnic ties to India and South East Asia. CAS [Origin of European 3/6] First Farmer of Europe and Y-DNA Haplogroup G The effective mutation rate at Y chromosome short tandem repeats, with application to human population-divergence time. Such temporal estimates must be viewed with caution owing to differences in individual STR locus mutation rates, sensitivity to rare outlier STR alleles and complexities related to multiple potential founders during a demographic event. A clade of closely related Ashkenazi Jews represent virtually all G2b persons, with just three other G2b haplotypes having been reported so far: one Turk from Kars in northeast Turkey near Armenia, one Pashtun, and one Burusho in Pakistan. You are using a browser version with limited support for CSS. Furthermore, markers Page94, U5, U8 and L30 were typed in contextually appropriate samples to establish the position of the five new markers within the phylogeny. They are found only in tiny numbers elsewhere. G-P16 has a high frequency in South and NW Caucasus, with the highest frequency among North Ossetians63.6%. G2a2b1 is more common in southern Europe than northern Europe. Y chromosomal heritage of Croatian population and its island isolates. 8 Oldest Haplogroups and the Regions they Originated From While acknowledging that the inference of the age and geographic source of dispersals of Y chromosome haplogroups from the frequency and STR diversity data can be approximate at best, we speculate that this lineage could potentially be associated with the Linearbandkeramik (LBK) culture of Central Europe, as its highest frequency (3.45.1%) and Td estimate (Supplementary Table S4) of 108703029 years ago occur there. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters. Although M527 frequency (Supplementary Table S1) is relatively low (16%), its phylogeographic distribution in regions such as southern Italy, Ukraine and the Levant (Druze and Palestinians) often coincides with areas associated with the Neolithic and post-Neolithic expansions into the Greek Aegean beginning approximately 7000 years ago.41 The expansion time (Td) of M527 is 71002300 years ago and is consistent with a Middle to Late Neolithic expansion of M527 in the Aegean. Correspondence to Frontiers | The Geographic Origins of Ethnic Groups in the Indian PLoS One 2009; 4: e5792. The identification of a new SNP can necessitate renaming of one or more categories. G is found mostly in the north central Middle East and the Caucasus, with smaller numbers around the Mediterranean and eastward. Although not exceeding 3% frequency overall, haplogroup G1-M285 reflects a branching event that is phylogenetically equivalent to the more widespread companion G2-P287 branch in the sense that both branches coalesce directly to the root of G-M201. Although hg G1 frequency distribution, overall, extends further eastward as far as Central Asian Kazakhs (present even among Altaian Kazakhs38 with identical STR haplotypes compared with the main Kazakh population), it is virtually absent in Europe. Keller A, Graefen A, Ball M et al. volume20,pages 12751282 (2012)Cite this article. Spatial autocorrelation analysis was carried out to assess the presence/absence of clines regarding informative G sub-haplogroups. Russ J Genet 2004; 40: 326331. The oldest skeletons confirmed by ancient DNA testing as carrying haplogroup G2a were five found in the Avellaner cave burial site, near Les Planes d'Hostoles, in Catalonia, Spain and were dated by radiocarbon dating to about 5000 BCE. The frequency pattern and the microsatellite network of E-M2(xM191) indicate a West African origin followed by expansion, a result that is in agreement with the findings of Cruciani et al. This is not surprising, as clines are not expected in cases of sharp changes in haplogroup frequency over a relatively small distance such as those observed for hg G, for instance between the Caucasus and Eastern Europe. Where did the haplogroup G-M201 originate? - Quora Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF : New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. Samples have been identified in England, Germany, Montenegro (Bosniak), Spain, Cyprus (Greek), Turkey, Armenia, Georgia, Lebanon, Syria and Kuwait. [39], Haplogroup G-M377 has been found at a frequency of 60% out of a sample of five Pashtuns in the Wardak region of Afghanistan. Farther north, 8% of ethnic Hungarian males and 5.1% of ethnic Bohemian (Czech) males have been found to belong to Haplogroup G. In South Asia, some ethnic minorities possess haplogroup G at concentrations of approximately 18%[21] to 20%[22] of Kalash, approximately 16% of Brahui,[22] and approximately 11.5% of sampled Pashtun,[21] but in only about 3% of the general Pakistani population. Hg G is very frequent in NW Caucasus and South Caucasus, covering about 45% of the paternal lineages in both regions2 in this study. Although the low frequency of hg G1-M285 makes it impractical to justify displaying a spatial frequency map, it is found (Supplementary Table S1) in the Near/Middle East including Anatolia, the Arabian Peninsula and Persian Gulf region, as well as Iran and the South Caucasus (mostly Armenians). Circles represent microsatellite haplotypes, the areas of the circles and sectors are proportional to haplotype frequency (smallest circle corresponds to one individual) and the geographic area is indicated by color. Phylogenetic relationships of studied binary markers within haplogroup G in wider context of M89-defined clade. G2a2b1 so far has seldom surfaced in northern Africa or southern Asia, but represents a small percentage of the G population in the Caucasus Mountains region and in Iran. JD and JC were supported by ANR program AFGHAPOP No BLAN07-9_222301. Distinguishing the co-ancestries of haplogroup G Y-chromosomes in the It has an extremely low frequency in modern populations, except (i) Iran and its western neighbors, and (ii) a region straddling south Central Siberia (Russia) and northern Kazakhstan. Genomics 1999; 57: 433437. . Article G-M201 has also been found in Neolithic Anatolian sites such as Boncuklu dating back to 8300-7600 BCE, and Barcin dating back to 6419-6238 BCE. The genome-wide structure of the Jewish people. Barac L, Pericic M, Klaric IM et al. Thus inferences regarding migratory histories must be viewed cautiously, as diversities may have changed over the time spans discussed. P257 was first reported in 2008. Here we present the haplogroup frequency distribution and STR variation of 16 informative G sub-clades by evaluating 1472 haplogroup G chromosomes belonging to 98 populations ranging from Europe to Pakistan. Mitochondrial DNA and Y Chromosome Variation Provides Evidence for a Recent Common Ancestry between Native Americans and Indigenous Altaians. Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the Mediterranean area. International Society of Genetic Genealogy (ISOGG; 2015), "Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences", https://en.wikipedia.org/w/index.php?title=Haplogroup_G-M201&oldid=1139571590, Articles with dead external links from January 2020, Articles with permanently dead external links, All articles with bare URLs for citations, Articles with bare URLs for citations from April 2022, Articles with spreadsheet file bare URLs for citations, Short description is different from Wikidata, Articles with self-published sources from October 2020, Articles with unsourced statements from November 2017, Articles with unsourced statements from September 2022, Articles with unsourced statements from July 2017, Wikipedia articles in need of updating from February 2021, All Wikipedia articles in need of updating, Creative Commons Attribution-ShareAlike License 3.0, M201, PF2957, L116, L154, L204, L240, L269, L402, L520, L521, L522, L523, L605, L769, L770, L836, L837, M201, P257/U6, Page94/U17, U2, U3, U7, U12, U20, U21, U23, U33, Other males purported to be members of Haplogroup G include: German-American pioneer and soldier, This page was last edited on 15 February 2023, at 20:17. The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. Parallel evolution of genes and languages in the Caucasus region. and JavaScript. [43] L240 was identified in 2009. In Europeexcept in Italy G2a2b1 constitutes less than 20% of G samples. This haplogroup was found in a Neolithic skeleton from around 5000 BC, in the cemetery of Derenburg Meerenstieg II, Germany, which forms part of the Linear Pottery culture, known in German as Linearbandkeramik (LBK),[11] but was not tested for G2a3 subclades. Haplogroup - an overview | ScienceDirect Topics Should any man with the P15 mutation test negative (ancestral) for any of these or vice versa, that finding would be the basis of a new G2a category. The L141 mutation is found on the Y chromosome at 2948607. We emphasize that our assessments are based solely on contemporary DNA distributions rather than actual prehistoric patterns. New York: Columbia University Press, 1987. It remains to be seen if testing will reveal G-M377 haplotypes in other populations this is some indication that G-M377 occurs at low levels in the Near East. Eur J Hum Genet 2010; 18: 463470. Haplogroup G first locations (T. Kandell). The haplogroup G mutation developed about 21,000 to 14,000 years ago. Am J Hum Genet 2012; 90: 573. RV and DMB thank the European Commission, Directorate-General for Research for FP7 Ecogene grant 205419. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. "[3], Previously the National Geographic Society placed its origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic. But a high percentage of U1 men belong to its two subclades, G-L13/S13 and Z1266 (G2a3b1a1b). The Caucasus as an asymmetric semipermeable barrier to ancient human migrations. It is notable that tzi the 5300-year-old Alpine mummy was derived for the L91 SNP and his autosomal affinity was nearest to modern Sardinians.28, The G2a2-M286 lineage is very rare, so far detected only in some individuals in Anatolia and the South Caucasus. (a) Principal component analysis by population. M286 was first identified at Stanford University at chromosome position 21151187, and is a mutation from G to A. It was then learned that several subclades belong under L223, including: G-L91 was identified in 2009. Zhivotovsky LA, Underhill PA, Cinnioglu C et al. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. In human genetics, Haplogroup G-P303 ( G2a2b2a, [2] formerly G2a3b1) is a Y-chromosome haplogroup. Samples from persons with British Isles, Sicilian and Turkish ancestry have been identified. Important caveats to consider include the fact that Td is sensitive to authentic rare outlier alleles and that multiple founders during population formation will inflate the age estimate of the event. White PS, Tatum OL, Deaven LL, Longmire JL : New, male-specific microsatellite markers from the human Y chromosome. The network was obtained using the biallelic markers P303, M426, L497, U1, M527 and 19 STR loci (DYS19, DYS388, DYS389I, DYS389b, DYS390, DYS391, DYS392, DYS393, DYS439, DYS461 (TAGA counts), DYS385a,b, DYS437, DYS438, DYS448, DYS456, DYS458, DYS635, YGATAH4). Although compared with G1-M285, the phylogenetic level of P303 (Figure 1) is shallower but its geographic spread zone covers the whole hg G distribution area (Figure 2b). No labs have yet assigned them shorthand names. The authors declare no conflict of interest. These are found at: rs9786910, rs9786537, rs2713254, rs35567891 and rs34621155 on the Y chromosome. [20] The city is on the banks of the river Drava, which notably begins in the Tirol/Tyrol region of the Alps, another haplogroup G focus area in Europe. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa . [25], In the Middle East, haplogroup G accounts for about 3% of the population in almost all areas. The most commonly occurring subclades are G1* (M285) and many subclades of G2 (G-P287), especially: G2a (P15), G2a1 (G-FGC7535, formerly G-L293), G2a2b2a (G-P303) formerly G2a3b1); G2a2b1 (G-M406) formerly G2a3a; G2a2b2a1 (G-L140) formerly G2a3b1a; G2a2b2a1a1b (G-L497) formerly G2a3b1a2; G2a2b2a1a1a1 (G-L13) formerly G2a3b1a1a; G2a2b2a1a1c1a (G-CTS5990 or G-Z1903) formerly G2a3b1a3; G2b (G-M3115) and; G2b1 (G-M377), formerly G2b. Categories have alternating letters and numbers. The coming of the Greeks to Provence and Corsica: Y-chromosome models of archaic Greek colonization of the western Mediterranean. This group has been linked with the Crypto-Jewish population which fled to the island during the time of the Spanish Inquisition, of which a significant portion are identifiable as G-Z725 (DYS388=13). Am J Hum Genet 2004; 74: 10231034. Haplogroup_G_(Y-DNA)
East High School Youngstown, Ohio Alumni, Articles H